Activation function-1 (AF-1) of retinoic acid receptor -2 is an acidic activator resembling VP16

Gert E. Folkers, Erika C. van Heerde and Paul T. van der Saag

Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Utrecht, the Netherlands
 

The Journal of Biological Chemistry 270:23552-23559 (1995)
 

Abstact

The mechanisms underlying transcriptional activation are not very well understood and knowledge is based on experiments with a small number of mostly viral activators. We have investigated the mechanism underlying transactivation by the activation domain present in the N-terminal part of retinoic acid receptor (RAR) 2 (AF-1). We show that RAR2 phosphorylation is not crucial for its activity although it may modulate AF-1 activity. Sequential mutation of the negatively charged residues (Asp) resulted in a stepwise decrease in activity, while mutation of all aspartic acid residues resulted in complete loss of activity. Comparison of the critical region for activation with other activators revealed moderate homology with the viral activator VP16. The hydrophobic amino acids surrounding the negatively charged residues reported to be critical for activation by VP16, are all conserved in AF-1. The hydrophobic residues are required for AF-1, since mutation of these residues resulted in a decrease in activity. Furthermore the activity of this activator, VP16 and TA₁ of RelA, is squelched by overexpression of an AF-1 containing expression construct, indicating that AF-1 is an acidic activator. Squelching experiments further indicate that AF-1 and AF-2 function by different mechanisms. Comparison of activation functions present in the AB-region of other members of the steroid/thyroid hormone receptor family: RAR2, RAR2 and GR suggested that also these receptors contain an acidic activation domain. The mechanism underlying activation by AF-1 is discussed.
 
back

Introduction

Transcription of RNA polymerase II (Pol II) promoters requires an assembly of the pre-initiation complex consisting of basal transcription factors. This process begins with the binding of TFIID to the TATA-box, followed by ordered binding of the other transcription factors (TFIIA,-B,-E,-F,-H) and RNA polymerase forming the initiation-complex (1,2). Transcription factors bound to promoter or enhancer sequences modulate the activity of Pol II promoters. Transcription factors contain a DNA binding domain (DBD) and an activation function (AF), each of which are interchangable units, and generally are functioning independently when coupled to a heterologous AF or DBD (3). Activation functions/activators are regions of 30-100 amino acids (aa) in length and can be classified by their sequence similarity or the presence of predominant amino acids: acidic, glutamine or proline rich (4). Presently little is known about the exact role of the predominant amino acids (Asp/Glu, Gln or Pro) in activators and it is unclear whether secondary structure is required for activation. Mutational analysis of acidic activators has shown that negative charge per se is not sufficient for activation as mutation of negative to neutral or even positive amino acids (aa) does not or only marginally interfere with activation capacity (5). An amphipathic -helix, with negatively charged residues on one surface and hydrophobic residues on the other, could be a requirement for activation (6). However, also some mutations destroying the putative alpha helix remain active (5). Based on mutational analysis, the GAL4 activator was proposed to form an antiparallel -sheet structure (7). Using circular dichroism the presence of this structure (under slightly acid conditions) was confirmed (8). Structural analysis using NMR has not provided any evidence for the presence of stable secondary structure elements in any activator analyzed so far.

The mechanism by which these activators exert their effect is currently a point of discussion. The removal of repressors interacting with a component of TFIID by activators was proposed (9). Furthermore it has been suggested that activators can facilitate steps in the formation of the pre-initiation complex by interacting with a component of this complex (10, and references therein). Thereby the assembly of the pre-initiation complex could be enhanced and/or the number of active transcription complexes could be increased (11,12). Also the formation of an open complex following the formation of the initiation complex may be a target for an activator. Based on these models activators may modulate transcription in several ways, whereby generally an interaction with one or more components of the basal transcription machinery seems to be necessary. Several activators have been shown to interact with TATA-binding protein (TBP) (13-15), TFIIB (16-18) or TBP-associated factors (TAFs) (19,20). In some cases point mutants with reduced activity show also reduced in vitro binding (14,21,22). Occasionally however, a bridging-factor/ cofactor is needed for activation, possibly indirectly connecting the activator with a component of the pre-initation complex (9). The observation that the AFs of the estrogen receptor (ER) function in a cell-specific way and the observed promoter specificity of the AFs of ER (23) has led to the hypothesis that cofactors are required for the activity of the activators. The requirement for cofactors both in vitro and in vivo has recently been confirmed (24,25). Different requirement for transcriptional activation may be phosphorylation. The activity of several transcription factors, e.g. CREB and c-jun have been shown to be upregulated by phosphorylation (for review see 26). Also steroid hormone receptors are phosphorylated in vivo (27).

RARs belong to the steroid/thyroid hormone receptor superfamily which share a common domain structure, denoted A-F (28,29). The C region contains the DNA-binding domain which is most conserved among the different members of this family and consists of two zinc fingers. The hormone-binding domain is located in the E region and contains besides the binding domain a dimerization domain and a hormone-dependent transactivation function (AF-2). The N-terminal part of the receptor (AB) also contains an autonomous region involved in transactivation (AF-1) which functions independently of ligand, when coupled to a heterologous DNA-binding domain (28,29). We and others have previously reported the presence of two autonomous transcriptional activation functions in RAR which both activate transcription by different, cell-type and promoter dependent mechanisms (30,31). The activation function present in the N-terminal part of the protein (AF-1, formerly called TAF-1), is located in the first 32 aa of the receptor, and functions both in the presence and absence of RA. This region is negatively charged and contains putative phosphorylation sites, but no obvious homology with known activators was observed (30).

Since no activation function present in the AB-region of a member of this superfamily has been analyzed in detail so far, we decided to characterize AF-1 of RAR2 in more detail. Here we show that AF-1 is an acidic activator, three aspartic acids present in this region are required for its activity and the hydrophobic residues contribute to activity. Sequence comparison revealed that this activation function has homology with the acidic transactivation domain of VP16.

back

Material and Methods
 

Plasmids

By site-directed mutagenesis (altered site kit, Promega) we introduced a SmaI site in front of the ATG of RAR2 in the same reading frame as the SmaI site of pGEX 2T and pSG424 (GST and GAL-DBD respectivily, seq: GCAGACATTCAGTG-CCCGGGGATCATGTTTGAC). All mutants were made by PCR or using site-directed mutagenesis and cloned to GAL-RAR -CF, containing the first 76 aa of RAR2 fused to the DBD of GAL4 (1-147) (30) and pSG5-RAR using the SmaI and XhoI sites. RAR A was constructed by PCR using a primer (SEQ: tcccccGGGATCAATTGAAACACAGAGCA) containing a SmaI in front of the first amino acid of the B-region in the same reading-frame as the SmaI site of HA-tag RAR (an expression vector containing the Hemagglutine-tag and a SmaI site in front of the ATG of RAR) and primer Drev (GTGCATTCTTGCTTCGAAGT); this Sma-Xho digested PCR product was cloned in the corresponding sites of HA-tag RAR. Digestion of this plasmid with SmaI and XhoI, Klenow treatment, and ligation resulted in RAR AB. RAR 1-27 was made by cloning the HinfI (blunt)-XhoI fragment in SmaI-XhoI digested pSG5 RAR, starting at aa 27, the first ATG. HA-tag RAR E was made by cloning the XhoI-Xba fragment from RAR E (30) in the corresponding HA-tag RAR sites. Cloning the KpnI-BamHI fragment from RAR E in the corresponding sites of the AB construct resulted in HA-tag-RAR AB,E. To generate GST-RAR 1-76 the SmaI-XhoI fragment of pSG5-RAR2 was ligated after Klenow treatment in the SmaI site of pGEX-2T and transformed to E-coli Jm101. All constructs were sequenced to check mutations and reading frames: expression was confirmed by western blot using a polyclonal antibody against the F-region of RAR or an anti-GAL antibody.
 

Transfection and CAT-assay

Transfections were carried out by calcium phosphate co-precipitation as reported before (30). 8 µg reporter 5X GAL-CAT (5 GAL binding sites in front of an E1b tata-box-CAT, (32)), mCRBPII-CAT or hRAR2-CAT (-63/+156; 33), 1 µg expression vector (GAL-RAR fusion constructs pSG424 or pSG5-RAR and pSG5-RXR) together with 1.5 µg SV2-LacZ as reference plasmid. For preparation of whole cell extract 10 µg expression construct was transfected. After removal of the precipitate, 1.0 µM RA was added when indicated and after a subsequent 24 hr cells were harvested. CAT assay was performed as described; for quantification a phosphorimager (Molecular Dynamics) was employed and percentage conversion was normalized for transfection efficiency using the -galactosidase assay (30). Transfection was performed using at least two different batches of expression vector DNA and data are presented as the mean (relative activity or CAT-activity) of at least five independent or three duplicate experiments with the S.E.M. between the different experiments generally less than 15%.
 

Western blotting

Whole cell extract (WCE) from transiently transfected COS cells was prepared by three subsequent freeze/thaw cycles (-80^oC/4^oC) in 50-100 µl lysis buffer (20 mM Tris pH 7.5, 20% (v/v) glycerol and 400 mM KCl) together with 0.2 mM PMSF and protease inhibitors (aprotinin, leupeptin, pepstatin and chymostatin, final concentration 1.0 µg/ml of each). Equivalent amounts of extract were loaded and separated on 8-12.5% (w/v) SDS-PAGE and transferred to nitrocellulose using a semi-dry blot apparatus. Membranes were blocked in 4% (w/v) nonfat dry milk in PBST (150 mM NaCl, 16 mM Na₂HPO₄ and 4 mM NaH₂PO₄ and 1% (v/v) Tween 20) for 1 hr. Blots were incubated using either a monoclonal against GAL-DBD (1:750) or a polyclonal against the F region of RAR (RP(F)112, 34) (1:750) in PBST containing 2% (w/v) nonfat dry milk for 2 hrs. After 7 washes in PBST, blots were incubated with peroxidase conjugated second antibodies in PBST containing 2% (w/v) nonfat dry milk. After 7 washes with PBST blots were developed using the ECL kit (Amersham).
 

In vivo labeling and Immunoprecipitation

Cells were transfected as described and 24 hrs post transfection medium was changed for phosphate-free DF medium containing 7.5% (v/v) dialyzed serum and cells were labeled with 1 mCi ³²P-orthophosphate/ml (ICN), for 4 hrs. 1.0 µM RA was added together with ³²P-ortophosphate (4 hrs). Cells were washed with cold PBSø (150 mM NaCl, 16mM Na₂HPO₄ and 4 mM NaH₂PO₄), scraped in PBSø and lysed in 40 µl lysis buffer (see western blotting). After centrifugation the cell lysate was precleared in 750 µl IP-buffer (50 mM Tris pH 7.5, 100 mM NaCl, 5 mM EDTA, 1% (v/v) Triton X100) containing 0.2mM PMSF and protease inhibitors using 1 µl normal mouse serum and 50 µl 50% (v/v) slurry protein A-sepharose in IP-buffer. 50 mM NaF, 40 mM -glycerophosphate and 0.2 mM NaVO₄ was added to both lysis and IP buffer. The lysates were then incubated for 2 hrs with 50 µl 12CA5 hybridoma supernatant, thereafter 50 µl 50% (v/v) slurry protein A-Sepharose in IP buffer was added and incubated for another hour. Beads were washed 3 times with 1 ml IP buffer, once with 100 mM Tris-HCl pH 7.5, 0.5 M LiCl (1ml) and once with 10 mM Tris-HCl pH 7.5 (1ml). Immuno complexes were eluted by incubation at 100^oC for 5 min in sample buffer and run on a 10-12.5% (w/v) SDS-PAGE gel.

back

Results

The first 32 amino acids of RAR2 are required and sufficient for AF-1 activity

We have previously shown that, when coupled to the DNA-binding domain (DBD) of GAL4, the first 32 amino acids are required and sufficient for transactivation (30). RAR lacking the AB region showed decreased transactivation capacity, which is dependent on the promoter used (30,35). Results obtained with GAL-fusion constructs are sometimes different from results with the same activation function in its normal protein context. To determine whether the first 32 amino acids are also sufficient for AF-1 activity in the receptor context we made several RAR deletion constructs, as shown in Figure 1A. All mutants were translated properly and accumulated to similar levels as judged by western blot of extracts of COS cells transfected with these mutants; only the expression of 1-27 is slightly lower, because it lacks a consensus Kozak sequence (Figure 1B). These mutant receptors were transfected in COS-1 cells together with the CRBPII promoter coupled to the CAT gene. This promoter has been shown to be only activated by AF-1 and not by AF-2 of RAR2 (35). Figure 1B shows a quantification of these transfections; no activity was observed in the absence of RA and activity was dependent on cotransfection of RARs. Constructs lacking the A or AB region no longer activated the CRBPII promoter as has been reported before (35). The mutant receptors 1-27 and 11-22, which were no longer active when fused to GAL-DBD, were also unable to activate transcription of the CRBPII promoter. The receptor containing only the first 32 residues (33-76) however, was still able to activate this promoter albeit to a lesser extend than the full length receptor. From these data we conclude that the first 32 amino acids of RAR-2 are required and probably sufficient for the activity of AF-1, both when present in the normal receptor context and when fused to a heterologous DBD.
 
 

Phosphorylation is not required for transactivation by AF-1

The observation that RARs are phosphorylated in vivo (34,36,37) and recent observations by us unpublished results) and others (38) that the activity of RARs can be upregulated by protein kinase A, indicated that phosphorylation may be important for the activity of AF-1.

To test whether phosphorylation is involved in the activity of AF-1 we changed the tyrosine, threonine and all serine residues present in this region to alanine and tested the ability of these mutants to activate transcription, when coupled to GAL-DBD. Figure 2 shows the quantification of CAT-assays of COS cells transfected with these mutants. It is clear from these results that all mutants are still active; only mutation of Serine 22,24,25 to Alanine showed a 35% reduction in activity. These transfection data indicated that the putative phosphorylation sites are not absolutely required for AF-1 activity, but that they can however influence the activity. A decrease in the in vivo phosphorylation levels might be expected upon mutation of the putative phosphorylation sites. Therefore in vivo phosphorylation experiments using the indicated mutants in the HA-RAR E constructs (containing a hemagglutinin tag in front of the AB-region in the RAR expression-construct lacking the hormone binding domain) were performed. No obvious differences in phosphorylation levels for the various mutants were observed (data not shown). Since we were not able to map the phosporylation sites within this region it is possible that not the absence of phosphorylation is the cause of this decrease but rather the introduction of Ala instead of Ser residues. An alternative explanation could be that the kinase responsible for this phosphorylation event, is induced upon RA treatment and a 4 hour RA treatment in the in vivo phosphorylation experiment is too short to see the differences in phosphorylation levels between wild type and mutants. From these data we conclude that phosphorylation is not crucial for AF-1 activity, although it may modulate the activity of this activator.
 

Negatively charged amino acids are responsible for AF-1 activity

We have observed that RAR AF-1 when fused to GAL-DBD is capable of activating transcription synergistically upon multimerization of GAL-binding sites (Folkers et al., submitted), similar as has been reported for VP-16 (39). Therefore it can be hypothesized that these activators function by similar mechanisms. Experiments with VP16 have indicated that negatively charged amino acids are involved in and are required for the activity of VP-16. Moreover the hydrophobic residues surrounding the Asp/Glu residues are required for its activity (5). Analysis of the minimal autonomous activation region of AF-1 (aa 1-32) indicated that this region is overall negatively charged, implying that negatively charged residues could be involved in the activity of AF-1. To test this hypothesis we first mutated all negatively charged amino acids individually to non-charged residues (Ala) and transfected these GAL-DBD coupled mutants together with a GAL-responsive reporter in COS cells. We observed a considerable decrease in CAT-activity of the mutant activator when compared to wild type, as shown in Figure 3. Also the conversion of D17 to threonine resulted in a similar decrease in activity, showing that not only an aspartic acid to alanine substitution is destructive (data not shown). Subsequently multiple aspartic acid residues were changed simultaneously to alanines causing a further decrease in activity and upon alteration of all aspartic acid residues nearly all activity was lost (Figure 3).

Next we asked whether negative charge per se is needed or whether the presence of these specific negatively charged amino acids is required. Mutation of D3,6 to glutamic acid, which has been shown previously to be a poor substitute for aspartic acid in case of VP16 (5), resulted in a decrease almost as strong as the corresponding Ala mutant. We then attempted to create a stronger activator by introducing extra negative charge. Changing LDF (16-18) to aspartic acid residues (DDD) did not result in a receptor with higher activity but instead a small decrease was observed. Above we have shown that replacement of S22,24,25A resulted in a decrease in activity (Figure 2), Upon changing the serine residues of this putative phosphorylation site to aspartic acid a stronger activator was created (Figure 3), showing the importance of negative charge for activation and suggesting that phosphorylation can, by introducing extra negative charge, modulate the activity of this activator.
 

Hydrophobic residues contribute to AF-1 activity

We then tested whether hydrophobic amino acids, like in VP16, are also required for activation. Mutation of F2P and M5P resulted in a significant decrease (38 and 35% respectively), while alteration of the hydrophobic Val to Ala caused a larger (62%) reduction in activity (Figure 4). The decrease in activity by mutation of hydrophobic acid residues is not as strong as reported for the F442P mutant of VP16 (40). These data indicate that although the mutation of aspartic acid residues caused a stronger decrease in activity, the hydrophobic residues substantially contribute to the activity of AF-1.

Transfection of these mutants in P19 EC cells gave similar results, confirming that the negatively charged residues are most important for activation (data not shown). To confirm that the previous results are not caused by differential stability or accumulation of the various proteins, we performed Western blots using both the GAL-RAR AF-1 fusion constructs and mutant receptors, containing the same mutations in the RAR expression construct. All proteins migrated according to their expected molecular weight and the variations in expression levels were not more than two-fold (data not shown).

Next we examined whether the critical amino acids of AF-1 when present in the fusion constructs, are also the most important residues for AF-1 activity in the full-length receptor. We therefore compared the activity of each mutant AF-1 by transfecting them as GAL-fusion construct as well as within the normal receptor context on the CRBPII promoter and on the hRAR promoter. By comparing the transactivation capacity of all

AF-1 is an acidic activator

Comparison of several domains which have been shown to belong to the class of acidic activators (VP16 (5), RelA, (42,43) Rta2 (44)) revealed a striking similarity as depicted in Figure 6. The positions of hydrophobic () and negatively charged (-) residues is mostly conserved, with hydrophobic residues at positions 2, 5, 7 or 8 while generally at least two of the residues between these hydrophobic amino acids are negatively charged. This pattern was also found in RAR2 and RAR2, suggesting that also these receptors contain an autonomous activator at the N-terminus that belongs to the class of acidic activators. Also in the activation domains of C/EBP, c-Fos, E1A and GR a sequence of hydrophobic residues around the aspartic acid and/or glutamic acid residues was found.
 

Discussion

In this paper we show that the autonomous activation function (AF-1) present at the N-terminus of RAR2, located between amino acid 1 and 32, is an acidic activator. This is supported by a number of observations. First the activity of this activator is depending on the presence of three aspartic acid residues and hydrophobic residues are also required for activity. The behavior of other mutant activators is in agreement with the working mechanism of acidic activators as mutation of all non-hydrophobic/negatively charged amino acids were permissive. Furthermore squelching experiments indicate that overexpression of an AF-1 containing construct interferes with the activity of VP16 and the recently characterized acidic activator TA₁ of RelA. These activators all share the ability to activate transcription synergistically upon multimerisation of binding sites (39,42,43, Folkers et al, submitted). Finally we observed sequence similarity between this activator and several other acidic activators, in which the position of critical hydrophobic and negatively charged residues is conserved.

The relatively high activity of VP16 and TA₁ of RelA compared with AF-1 of RAR (at least 10 times less active), can be explained by the presence of two or more regions involved in activation (40,42,43) and also by the presence of more negatively charged amino acids in VP16 or RelA (43). In case of RAR there are also two regions which contribute to the activity of AF-1 including the region around D3 and D6 and the region around D17. The first region is homologous with acidic activators whereas in the latter region only the presence of negative and hydrophobic residues was observed. Although we do not know how the latter region is contributing to activity, point mutants (D17A, L16,F18D) as well as deletion constructs (11-22 ,11-76(30)) indicate that it does contribute to the activity of this activator.
 

Phosphorylation modulates AF-1 activity

Phosphorylation experiments in COS-cells transfected with various RAR deletion constructs showed that multiple regions of RAR, including the AB-region, were phosphorylated (data not shown). Mutational analysis suggest that phosphorylation might modulate the activity of this autonomous activation function. The functional significance of the putative phosphorylation sites in AF-1 was established by introducing alanine residues for serine 22, 24 and 25 after which a decrease in activity became apparent. On the contrary, upon changing these residues to aspartic acid an increase in activity was observed. Similar findings have been reported for ER (45), c-jun (46) and p53 (47). A possible explanation is that phosphorylation introduces extra negative charge, which can be mimicked by introducing negatively charged amino acids. Recently phosphorylation sites of the estrogen receptor (45,48) have been mapped, and found also to be present within the transactivation domain of ER and these sites have been shown to contribute to the activity of the receptor. Although all experiments performed so far are in agreement with the model that phosphorylation modulates the activity of the activator, the specific sites have not been mapped since the levels of phosphorylation and/or expression of the transfected receptor were too low to perform tryptic phosphor-maps.
 

Primary and secondary structure of AF-1

Deletion analysis has revealed previously that the first 32 amino acids of RAR2 are required and sufficient for AF-1 activity (30). Here we show that the negatively charged and hydrophobic residues are important for the activity of this activator. Comparable findings have been reported for GAL4 (49,50), GCN4 (51) and VP16 (5, 52). It has been postulated that this class of activators form an amphipathic -helix with hydrophobic residues on one side with negatively charged residues on the other side of the helix (6). Using the Chou and Fasman (53) prediction an -helix could be formed over the first 9 residues, containing amino acids shown to be required for activation. This lead to the question whether structure is required for activation (54). We therefore expressed the first 76 aa of RAR in E-coli, purified the protein and performed CD and NMR analysis. Using 1D and 2D ¹H nuclear magnetic resonance no secondary structure could be demonstrated, although the CD measurements indicated the presence of low levels of secondary structure elements (K.Hård, R. Kaptein, unpublished results). Similar results have been obtained using the activation domains of VP16 (55) and TA₁ of RelA (43). The absence of secondary structure elements in activation domains is in agreement with the idea of the presence of so-called acid blobs in acidic activators (56). During the preparation of this manuscript the presence (in hydrophobic solvent) and significance of an -helical structure in the activation domain of GR was confirmed by CD and NMR analysis (57). This suggests that although in vitro (in aqueous solution) activators are largely unstructured (43, 55, 57, unpublished results), in vivo these proteins may adopt a helical structure. This latent secondary structure could be stabilized by secondary modifications (e.g. phosphorylation) or by the presence of other highly structured regions in the receptor (DNA- and hormone-binding domain). Furthermore it is also possible that structure is formed upon interaction of the receptor with DNA or with component(s) of the basal transcription machinery, as suggested by Sigler (56) and Frankel and Kim (58).
 

Modeling AF-1 as -helix

On the basis of the assumption that the class of acidic activators indeed form an -helix, we projected the first 8 aa of RAR2, the minimal activation domain of VP16 and several other activators to a helical wheel (58) (Figure 7) whereby in almost all cases the negative amino acids face one side of the helix and the hydrophobic residues the other side of the helix. From mutational analysis of both VP16 (5, 52) and Rta2 (EBV)(44) the Phe at position 5 in this helix is the most important and the residues close to this amino acid are generally hydrophobic while the residues at the other side of the helix (pos. 3,4,6) are negatively charged. The importance of negative/hydrophobic residues at these positions was confirmed by mutational analysis (52). These authors observed that four copies of the DDLDL or 2 copies of the DDFDLDL sequence is sufficient for activation and projection of these minimal activation units in a helical wheel confirms the presence of a hydrophobic and negatively charged side of the -helix in functional activators (data not shown). Further detailed mutational analysis of individual hydrophobic amino acids and combinations of these residues as well as structural analysis are required to confirm this model.

Recently the activation function present in the C-terminal part of the hormone binding domain (AF-2) of members of the steroid/thyroid hormone receptor superfamily has been characterized (60-64) and shown to depend also on the presence of hydrophobic and negatively charged residues and was proposed to form an -helix as well (62). The position of these residues is however different in AF-1 (DxD) as compared to AF-2 (xE) Furthermore the presence of glutamic acid can not be altered to aspartic acid (AF-2: 61,63) and vice versa (AF-1: D3,6E) without a decrease in activity. Finally squelching experiments showed that the activity of AF-2 can not be repressed by overexpression of AF-1 and vice versa (Figure 5B). Together these findings strongly suggest that these activators function by different mechanisms and each fulfill a different role in the retinoid response. This is confirmed by the observation that AF-1 and AF-2 contribute differently to the activation of various RA-dependent promoters (35). The characterization of the two activation functions present in these receptors will be helpful for a better understanding of the mechanism of action of these receptors in vivo.
 

Acknowledgements

We are grateful to Drs. P. Chambon and M.-P. Gaub for providing CRBPII-CAT and antisera against GAL-DBD and RAR. We thank Dr. P.A. Baeuerle for providing us with the Gal4-RelA-N and Dr. M. Parker for GAL GR AF-2. Furthermore the authors thank Drs. R. Boelens and B. van der Burg for critical reading of the manuscript. We acknowledge Drs. R. Knegtel and K. Hård for CD and NMR anlysis; Dr. R. Kaptein and Dr. S.W. de Laat for their continuous interest and support. We thank Patricia Swanink, F.J.M. Vervoordeldonk and J. Heinen for excellent technical assitance. G.E.F and E.C.v.H. are supported by the Dutch Cancer Society.

back

References

1. Buratowski, S. (1994) Cell 77, 1-3

2. Conaway, R.C., and Conaway, J.W. (1993) Annu. Rev. Biochem. 62, 161-190

3. Ptashne, M. (1988) Nature 335, 683-689

4. Mitchell, P.J., and Tjian, R. (1989) Science 245, 371-378

5. Cress, W.D., and Triezenberg, S.J. (1991) Science 251, 87-90

6. Giniger, E., and Ptashne, M. (1987) Nature 330, 670-672

7. Leuther, K.K., Salmeron, J.M., and Johnston, S.A. (1993) Cell 72, 575-585

8. Van Hoy, M., Leuther, K.K., Kodadek, T., and Johnston, S.A. (1993) Cell 72, 587-594

9. Meisterernst, M. and Roeder, R.G. (1991) Cell 67, 557-567

10. Choy, B., and Green, M.R. (1993) Nature 366, 531-536

11. Wang, W., Gralla, J.D., and Carey, M. (1992) Genes Dev. 6, 1716-1727

12. White, J.H., Brou, C., Wu, J., Burton, N, Egly, J.-M., and Chambon, P. (1991) Proc. Natl.Acad.Sci. USA 88, 7674-7678

13. Stringer, K.F., Ingles, C.J., and Greenblatt, J. (1990) Nature 345, 783-786

14. Lee, W.S., Kao, C.C., Bryant, G.O., Liu, X., and Berk, A.J. (1991) Cell 67, 365-376

15. Horikoshi, N., Maguire, K., Kralli, A., Maldonado, E., Reinberg, D., and Weinman, R. (1991) Proc. Natl. Acad. Sci. USA 88, 5124-5128

16. Baniahmad, A., Ha, I., Reinberg, D., Tsai,S., Tsai, M.-J., and O'Malley, B.W. (1993) Proc. Natl. Acad. Sci. USA 90, 8832-8836

17. Lin, Y.S., and Green, M.R. (1991) Cell 64, 971-981

18. Kim, T.K., and Roeder, R.G. (1994) Proc. Natl. Acad. Sci USA 91, 4170-4174

19. Gill, G., Pascal, E., Tseng, Z.H., and Tjian, R. (1994) Proc. Natl. Acad Sci USA 91, 192-196

20. Goodrich, J.A., Hoey, T., Thut, C.-J., Admon, A., and Tjian, R. (1993) Cell 75, 519- 530

21. Ingles, C.J., Shales, M., Cress, W.D., Triezenberg, S.J., and Greenblatt, J. (1991) Nature 365, 588-590

22. Geisberg, J.V., Lee, W.S., Berk, A.J., and Ricciardi, R.P. (1994) Proc. Natl. Acad. Sci. USA 91, 2488-2492

23. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., and Chambon, P. (1989) Cell 59, 477-487

24. Brou, C., Chaudhary, S., Davidson, I., Lutz, Y., Wu, J., Egly, J.-M., Tora, L., and Chambon, P. (1993a) EMBO J. 12, 489-499

25. Brou, C., Wu, J., Ali, S., Scheer, E., Lang, C., Davidson, I., Chambon, P., and Tora, L. (1993b) Nucleic Acid Res. 21, 5-12

26. Hunter, T., and Karin, M. (1992) Cell 70, 375-387

27. Orti, E., Bodwell, J.E. and Munck, A. (1992) Endocr. Rev. 13, 105-128

28. Evans, R.M. (1988) Science 240, 889-895

29. Leid, M., Kastner, P., and Chambon, P. (1992) Tr. Bioch. Sci. 17, 427-433

30. Folkers, G.E., Leede, B.-J.M. van der, and Saag, P.T.van der, (1993) Mol. Endocrinol. 7, 616-627

31. Nagpal, S., Friand, S., Nakshatri, H., and Chambon, P. (1993) EMBO J. 12, 2349-2360

32. Lillie, J.W., and Green, M.R. (1989) Nature 338, 39-44

33. Kruyt, F.A.E., Folkers, G.E., Walhout, A.J.M., Leede, B.-J.M. van der, and Saag, P.T. van der (1993) Mol. Endocrin. 7, 604-615

34. Rochette-Egly, C., Gaub, M.-P., Lutz, Y., Ali, S., Scheuer, I., and Chambon, P. (1992) Mol.Endocrin. 6, 2197-2209

35. Nagpal, S., Saunders, M., Kastner, P., Durand, B., Nakshatri, H., and Chambon, P. (1992) Cell 70, 1007-1019

36. Rochette-Egly, Y., Lutz, Y., Saunders, M., Scheuer, I., Gaub, M.-P., and Chambon, P. (1991) J. Cell. Biol. 115, 535-545

37. Gaub, M.P., Rochette-Egly, C., Lutz, Y., Ali, S., Matthes, H., Scheuer, I., and Chambon, P. (1992) Exp. Cell Res. 201, 335-346

38. Huggenvik, J.I., Collard, M.W., Kim, Y.-W., and Sharma, R.P. (1993) Mol. Endocrin. 7, 543-550

39. Emami, K., and Carey, M. (1992) EMBO J. 11, 5005-5012

40. Regier, J.L., Shen, F., and Triezenberg, J. (1993) Proc. Natl. Acad. Sci. USA 90, 883-887

41. Ptashne, M., and Gann, A.A.F. (1990) Nature 346, 329-331

42. Blair, W.S., Bogard, H.P., Madore S.J. and Cullen B.R. (1994) Mol. Cell. Biol. 14,7226-7234

43. Schmitz, M.L., Santos Silva, dos M.A., Altmann, H., Czisch, M., Holak, T.A., and Baeuerle, P.A. (1994) J.Biol. Chem. 269, 25613-25620

44. Hardwick, J.M., Tse, L., Applegren, N., Nicholas, J., and Veliuona, M.A. (1992) J. Virol. 66, 5500-5508

45. Ali, S., Metzger, D., Bornert, J.-M., and Chambon, P. (1993) EMBO J. 12, 1153-1160

46. Hoeffler, W.K., Levinson, A.D., and Bauer, E.A. (1994) Nucleic Acid Res. 22, 1305-1312

47. Milne, D.M., Palmer, R.H., and Meek, D.W. (1992) Nucleic Acid Res. 20, 5565-5570

48. Le Goff, P., Montano, M.R., Schodin, D.J., and Katzenellenbogen, B.S. (1994) J. Biol. Chem. 269, 4458-4466

49. Gill, G., and Ptashne, M. (1987) Cell 51, 121-126

50. Gill, G., Sadowski, I., and Ptashne, M. (1990) Proc. Natl. Acad. Sci. USA 87, 2127-2131

51. Hope, I.A., Mahadevan, S. and Struhl, K. (1988) Nature 333, 635-640

52. Siepel, K., Georgiev, O. and Schaffner, W. (1994) Biol. Chem. Hoppe-Seyler 375, 463- 470

53. Chou, P.Y. and Fasman, G.D. (1978) Annu. Rev. Biochem. 47, 251-276

54. Hahn, S. (1993) Cell 72, 481-483

55. O'Hare, P., and Williams, G. (1992) Biochemistry 31, 4150-4156

56. Sigler, P.B. (1988) Nature 333, 210-212

57. Dahlman-Wright, K., Baumann, H., McEwan, I.J., Almlöf, T., Wright, A.P.H., Gustafsson, J.-A. and Härd, T. (1995) Proc. Natl. Acad. Sci. USA 92, 1699-1703

58. Frankel, A.D., and Kim, P.S. (1991) Cell 65, 717-719

59. Schiffer, M. and Edmundson, A. (1967) Biophys. J. 7, 121-135

60. Barettino D., Vivanco Ruiz, M.d.M., and Stunnenberg, H.G. (1994) EMBO J. 13, 3039-3049

61. Durand, B., Saunders, M., Gaudon, C., Roy, B., Losson, R., and Chambon, P. (1994) EMBO J. 13, 5370-5382

62. Leng, X., Blanco, J., Tsai, S.Y., Ozato, K., O'Malley, B.W., and Tsai, M.-J. (1995) Mol. Cell. Biol. 15, 255-263

63. Tone, Y, Collingwood, T.N., Adams, M., and Chatterjee, V.K. (1994) J. Biol. Chem. 269, 31157-31161

64. Saatcioglu, F., Bartunek, P., Deng, T., Zenke, M., and Karin, M. (1993) Mol. Cell. Biol. 13, 3675-3685

index
homepage
 
 
 
 
 
 

.